Cloning and Analysis of the Promoter Region of Rat uPA Gene

Journal of Reproduction & Contraceptionhttp://www.RandC.cn2007 Mar; 18(1):1-10randc@sipp.stc.sh.cn●ORIGINAL PAPER●Cloning and Analysis of the Promoter Region of Rat uPAGeneYan LIU, Jin-wen XIONG, Li-gang CHEN, Yong-hong TIAN, Cheng-liang XIONGCenter of Reproductive of Medicine, Family Planning Research Institute, Tongji Medical College, HuazhongUniversity of Science and Technology, Wuhan 430030,ChinaObjectiveTo clone and analyze the promoter sequence of rat urokinase plasminogen .activator protein gene.Methods The genomic DNA was extracted from rat testicular tissue. According tourokinase plasminogen activator, the gene sense primer and antisense primer of uPAgene were designed and synthesized, then Touch-Down PCR were performed. Afterproper purification, the PCR product was sequenced, analyzed with the promoterprediction software and compared with the DNA sequence of rattuas urokinaseplasminogen activator.Results The cloned uPA gene was about 1 572 bp in length, which contained a fullopen- reading frame with 21 bp in length exons, and the upper region of transcriptionalstart was 1 551 bp in length which was eucaryon transcriptional control area.The 5' UTR had a promoter region including a non responsive TATA-box. Not only theGC-box binding region was found in this gene, but also active protein 1(API) and SPIwere seen in other regions.Conclusion A 1 572 bp uPA gene fragment (GenBank accession No.X65651) was .obtained. from rat genomic DNA library, containing eucaryon transcriptional controlarea with a promoter region, non-conspicuous TATA-box, GC-box and an extron. Anon-responsive TATA-box is located at the upper -30 region.Key words: rat; testicular tissue; urokinase plasminogen activator; Touch-Down PCR;promoter region; eucaryou transcriptional control area中国煤化工Corresponding author: Cheng liang XIONG; Tel: + 86-27-83692MYHCNMHGE-mail: clxiong95 l@sina.comUrokinase type plasminogen activator (uPA), a serine proteinase capable of activatinga cascade of proteolytic effct, is an inducible secreted serine protease found in vertebratesand is essential for normal matrix turnover. Study showed the extensive expression of uPA incontractile fber cells, blood serum, bronchus epithelial cell, blood vessel endothelium tissue,lung, enteric epithelium, placenta, allantoic veins endothelial cell, sertoli cll1-41. In thefibrinolytic system, the urokinase-type plasminogen activator(u-PA) interacts with itsmembrane receptor (u-PAR) and activates the single- chain proenzyme plasminogen to thetwo- chain broad-spectrum serine proteinase plasmin, which is able to degrade ECM bothdirectly and indirectly through activation of secreted pro MMPs. Moreover, uPA-uPAR-mediated signaling can up-regulate the production of matrix metalloproteases, which induceextracellular matrix degradation and, in turn, tumor invasion and metastasislS]. Urokinase-type plasminogen activator plays an important regulating role in tumor invasion migration,angiogenesis course, hemagglutination, cell adhesion, reconstruction and degradation ofextracellular matrix [6-12].Due to the rapid development of male reproductive health care in medical science, theeffects of uPA for male reproductive function is being followed with great interest. uPAproduced by caput and corpus epididymis may be involved in the acquirement of spermprogressive mtiliy3. It has already been reported that uPA gene plays an important role inthe process of spermatic volly, capacitation, sperm progressive motility, fertilization, acrosomalreation and so 01(15-1719. uPA could increase sperm motility and promote sperm movement,as well as induce sperm chemotactic responses, which is presumably one of the actionmechanisms of uPA on male infertility21.22. Highly viscous semen means that the semenwas liquefied but still with high viscosity. However, if highly viscous semen were treatedwith urokinase, sperm motility was increased[18] . Moreover, it has evidence suggests that totherapy highly viscous and low PSA(prostate specific antigen) sermen using urokinase is ahandy and effcacious methodl201. However, the possible mechanism of uPA gene for malereproductive function remains unanswered. There are few reports both at home and abroad.The end product of gene expression is protein, these substance and secondary productkeep sequence activity in the whole life. Gene expression regulation consists of transcriptionand translation, which transcription is the key control site. Moreover, regulation of promoteris the most important link to transcription. As general, eucaryou organism promoter containssuch enhancer elements as AP1, NFkB, etc, the binding of which to the correspondingtranscription factors will enhance gene transcription. Many molecular modulators likecellular CAMP, growth factors, TPA(tumor protective antigen) and others all regulate geneexpression through the transcription factors. As th中国煤化工r uPA proteinincreases mainly at genetic transcriptional level, TICHCNMHGed in our studyto clone DNA fragment of promoter region of the urA gene 1rom rat testiculus tissue. Thesequence was analyzed in order to further study the possible mechanism of expression andregulation of uPA gene for male reproductive function.Materials & MethodsAnimalThe SD rats were from medical animal center of Tongji Medical School, HuazhongUniversity of Science and Technology and weighted 220 g each. Having been bred separatedllyfor one week in our laboratory, the rat was injected intraperitoneally with 10% chloralhydrate (3 mg/kg). Testes of the rat were removed in sterilized condition and the rat wassacrificed. The testes were rinsed several times in stroke physiological saline solution andfreezed immediately in liquid nitrogen for future use.Prepare tissue for genomic DNA isolationTesticular tissue of 10-20 mg was dissected, freezel in liquid nitrogen and then grindedto a powder in a mortar prechilled with liquid nitrogen.Mammalian DNA isolationFor initial PCR analysis of clones, genomic DNA was isolated from testicular tissueaccording to a rapid miniprep method. The method was as follows: the prechill testiculustissue was transfered to a microfuge tube containing 600 μl of ice-cold cell lysis buffer(10 mmol/L Tris-Cl pH 8.0, 1 mmol/L EDTA pH 8.0, 0.1% (w/v) SDS); the suspension washomogenized quickly with 30 - 50 strokes of a microfuge pestle; 3 μl of proteinase K solution(20 mg/ml) was added to the lysate to increase the yield of genomic DNA; the digest wasincubated for 8 h at 55°C; the digest was allowed to cool to room temperature and then 3 μlof 4 mg/ml DNase- free RNase was added; the digest was incubated for 45 min at 37°C; thesample was allowed to cool to room temperature; 200 μl of potassium acetate solution(5 molLpotassium acetate, glacial acetic acid, H2O) was added and the contents of the tube wasmixed by vortexing vigorously for 20 s; the precipitated protein/SDS complex was pelletedby centrifugation at 9180X g for 3 min at 4C in a microfuge; the supernatant was transferedto a fresh microfuge tube containing 600 ul of isopropanol; the solution was mixed well andthen the precipitate of DNA was recovered by centrifuging the tube at9180X g for 1 minat room temperature in a microfuge; the supernatant was renoved by aspiration and 600 μul of70% ethanol was added to the DNA pellet; the tube was inverted several times andcentrifugedat 9180 X g for 1 min at room temperature;the supernatant was removedcarefully by aspiration and the DNA pellet was allowed to dry in air for 15 min; the pelletof DNA was redissolved in 100 μl of TE (10 mmol/L Tris-Cl, 1 mmol/L EDTA, pH 7.6).Optical Density numerical value read中国煤化工DNA solution of 20 μl was sucked and then dilHC N M H Garboil water.Sample OD26o/OD280 numerical value was read. DNA purity quotient and concentrationwas calculated and judged. The rest of DNA sample was preserved at -20"C to reserve.PCR reaction systemPrimers were designed by software primer 5.0 design. Primers were synthesized at theAoke company in Beijing(China). Upper primer: 5'-CAAATGCCTTTACGGTGTATG-3';lower primer: 5'- CGCAAGGACTGGATTGATG-3', PCR reactions contained 50 ng tem-plate DNA, 5 umol/L each of upper and lower primers, 200 umol/L deoxy (d)-ATP, dCTP,dGTP, and dTTP, 1 U native High Fidelity DNA polymerase, 2.5 μl 10 X PCR buffer [500mmolL KC1, 100 mmol/L Tris-HCl (pH 8.3)], 2 ul 25 mmol/L MgCl2 and 14.3 μl ddH2O in afinal volume of 25 μl.Touch-Down PCR reaction conditionBy use of Touch-Down PCR123.2421 clone, reactions were hot started at 94°C for 5 min(initial denaturation); one of the following cycle was performed: denaturation at 94°C for 40 s,annealing at 64°C for 45 s, and elongation at 72"C for 90 s; one of the following cycle wasperformed: denaturation at 94°C for 40 s, annealing at 63°C for 45 s, and elongation at 72Cfor 90 s; one of the following cycle was performed: denaturation at 94°C for 40 s, annealingat 62°C for 45 s, and elongation at 72°C for 90 s; one of the following cycle was performed:denaturation at 94C for 40 s, annealing at 61"C for 45 s, and elongation at 72C for 90 s; one .of the following cyclewas performed: denaturation at 94°C for 40 s, annealing at 60"Cfor 45 s, and elongation at 72°C for 90 s; one of the following cycle was performed: denatur-ation at 94°C for 40 s, annealing at 59C for 45 s, and elongation at 72°C for 90 s; one of thefollowing cycle was performed: denaturation at 94°C for 40 s, annealing at 58°C for 45 s, andelongation at 72°C for 90 s; one of the following cycles was performed: denaturation at 94°C .for 40 s, annealing at 57C for 45 s, and elongation at 72°C for 90 s; one of the followingcycle was performed: denaturation at 94°C for 40 s, annealing at 56°C for 45 s, and elonga-tion at 72°C for 90 s, and then 26 of the following cycles were per formed: denaturationat 94°C for 40 s, annealing at 59°C for 45 s, and elongation at 72°C for 90 s. After the lastcycle, a 10 min elongation at 72°C was performed.PCR production purify, T-A cloning and sequencingPCR production was purified according to the specification of kit (Shanghai SangonBiological Engineering Technology & Services Co.. Ltd, China), and then linked to PGEM-T Vector (Promega Corporation, USA). The system contained 1 μl PGEM-T Vector, 3 μlDNA (PCR product), 5 μl 2 X Rapid Ligation Buffer, 1 μl T4 DNA Ligase, and deionizedwater in a final reaction volume of 10 μl, the reactions were incubated overnight at 16C.Attachment body was put in JM109 high efficiency competent cells and then required inblue/white color screening on LB /AMP/X-Gal/IPTG plates. The gene fragment was registed.中国煤化工Rattus uPA gene promoter region analysisThe gene fragment was analyzed by promoteMYHCN M H Ghe flowingwebsites: .BDGP: htp://www .fruitfly .org/seq-tools/promoter.htmlCAU1.0: htp://epp.cau.ac.krDragon Promoter Finder: htp://reserch.i2r.a-star.edu.g/promoter/promoter1-/DFP htmlResultsThe purity quotient and concentration of DNA sampleOptical density numerical values of 4 tube DNA samples were read by turns, 0D260and OD280 numerical values were 0.801 ,0.413,0.438,0.235 and 0.734,0.387,0.183,0.100,respectively; OD260/OD280 numerical values were 1.840,1 .863,1.897,1.830, respectively. Theresults were optional according to the standard range1.6- 2.0.Rattus genomic DNA mass detectionGenomic DNA was electrophoresised by 0.3% sepharose/EB, and then the picturesuggests that DNA is not degradated (Figure 1).1,2,3,4 lanes are all rat's genomic DNAFigure 1 Rat's genomic DNA (approximately 50-100 kb)Touch-Down PCR production electrophoresisThe coloning fragment was electrophoresed by 0.7% sepharose/EB, the result wasdisplayed as follows (Figure 2).1-4: ratsM: markerFigure2 Rat's promoter region (1 572 bp)1 572 bp中国煤化工MYHCNMHG5PCR production sequencing and GenBank registThe gene fragment was registered (GenBank accession No.X6565 1), the sequencewas displayed as follows:-155 ICAAATGCCTTTACGGTGTATGATTGGCAGC AGGAGAGACGGCTCAGCTGT-1502-1501 AAAGGCTAGGCTCACCACCAAAGATAAAATGTGTAATTATCTTTTTACAA-1452-145 1TGGCTGATACGGGGACGTGTTTAAAGTTTTTAAAGCAGTGTGAAATAGCA-1402-1401TTCAGTGAAAAATAAACGTTCCTTTCACCTTGTCCCCCAGACCCACAGTCC-1352-1351CTCTACTAAAAGAGGAGAGCAGACACTCCCACCATTGTTTATAGCCCACA-1302-1301TTAACGAGGTTTGACCACTCCCTTGCCTTTTGTTTCTATCCTGCCACAAT-1252-125TTACTGTTCACACTAAGACTCCTGATTGAGCACTGATTGCTCTTCCAGAG-1202-I201GTCCTGAGTTCAATTCTC AGCAACCACACGGTGGCTCACAACCATCTGTA-1152-115 IATGGGATCCGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTATAGTGTAC-1102-I101TCATATACATACAATAAATAAATCTTAAAGACTCCCCCTCCCTTGATTGT-1052-1051TTATCTTTGTTTGTGTGCAACC ATAGTTCCACTGAGATCTGCACTCGGTC-1002-1001CTGTTCTGAGCTGCTCCTTGGTAGTATTCTTCCCCAGACAAATACATTTA-952-951 TTATAGGAATTTTTCAAAAGACCCATTGACACTTCAACCAGCCAATAGCA-902-901 GCTGGTGTCCTAAGACTTTGCTCCTACAATCCTATCAGATAGTAACCTTT-852-851 ATTGTTTTTTTTTAAATCATAATTATTTTTGAGGATTTCACTATGTAAAT-802-801 TAGGATGGGCTTGAACTTACAGAGATCCACTTGCCTCTTCCTCCCTAGTG-752-751 TTTGGATTGAAGGGTATGCCATTATGTCTGGCCCATGCCATATTTTTTT-702-701 TTTTTTCGGAGCTGGGGACCAAACCCAGGACCTTGCGCTTGCTAGGCAAG-652-651 CGCTCTACCACTGAGCTAAATCCCCAACCCCCCATGCCATAATTTCTAAA-602-601 ACCATCTTTCAAAGACTAGCCTTAAACCAAGCAGCAAGTCTGAATAAAAT-552-551 CTGACCTTTGCGTCTCACCCTCTGATGACACCCTTAACACTCCCTGACTA-502-501 CAAACTTCACTTTTGTCTTCTGATTCACTGGTTGTGTTAGTAATATTTGG-452-451 GGACTCAGCATTTGACATGTGGGAACCTTTGTGAGTAGGTTAGGAACTGT 402-401 GAATTATACACCTCTAAAGACATCTGAATCAATGTCGTAGGCAGGTAGGG-352-351 GGTCAAAGATGGACAGGTTGGAGAAGAACTGATTAAACCACTAAGGAAGA-302-301 GGCTTGAGGTCAGCAAGCCCATGTCTGGAGCGCCGTCACCACGCTACATT-252-251 GGGGCCACACTAGGTGAATGAAAGAATGGAAGAATGCACAAGCTGCTGGG-202-201 TCCCTCAGTCTAGACTGCGTTAGTTTGGTCAGCTGGAAATCCCATGACTT-152-!51 CGTCAAAGTCGGGAAGCAAGCGCTGTCC AGTTGCGGTGGGATGTAGGAAA-102-101 AGGAAAAGAAGGGAGAGAGCGCCGCCCTCCACCAAACCTGGGCGGGGCCC-52-51 GGGCCCGGGCGGGCCCTATTAAAGAGCGAGC AGCGCGGAGCAGTGAGTGG-2-1 AGCCTCAGAGCACCGTCTGTC+19uPA gene promoter region analysisSequencing length 322 bp was analyzed by software. The 5"UTR had a promoterregion including a non- responsive TATA-box, but which contains eucaryon transcriptionalcontrol area GC-box, AP-1,AP-4,SP1,NF-KB,GCF and so on.Upstream -35- -29 was anon-responsive TATA-box, -287-280 and -261-254 was AP-1-169- 160 was AP-4,-60-47and -54-49 was SP1 and- 58- 49 was GC box (Figu中国煤化工:ated that theregion was eucaryou transcriptional core area.rYHCNMHG-301 GGCTTGAGGTCAGCAAGCCCATGTCTGGAGCGCCGTC ACCACGCTACATT-252AP-1-251 GGGGCCAC ACTAGGTGAATGAAAGAATGGAAGAATGC ACAAGCTGCTGGG-202-201 TCCCTCAGTCTAGACTGCGTTAGTTTGGTC AGCTGGAAATCCCATGACTT-152AP4-151 CGTCAAAGTCGGGAAGCAAGCGCTGTCCAGTTGCGGTGGGATGTAGGAAA-102-101 AGGAAAAGAAGGGAGAGAGCGCCGCCCTCCACCAAACCTGGGCGGGGCCC-52GC box-51 GGGCCCGGGCGGGCCCTATTAAAGAGCGAGCAGCGCGGAGCAGTGAGTGG-2Sp1TATA box-1 AGCCTCAGAGCACCGTCTGTC+19The sequence of the rattus uPA gene upstream of the coding region is shown. The A of the translationalstart codon is numbered as-1 .GC boxes and ovals represent potential binding sites for the indicated trans- actingfactors. The locations of the essential promoter region and the transcription initiation window are shown byunderline.Figure 3 Rat's urokinase plasminogen activator promoter regionDiscussionAn enormous body of work generated over the past three decades has revealed thateukaryotic gene transcription is a remarkably intricate biochemical process that is tightlyregulated at many levels. Biochemical and genetic analysis of various model organisms hasidentified an astounding number of protein factors responsible for transcriptional control[25).Most genes are regulated by mixing and matching different types of activators and repres-sors in a coordinated fashion. Many researches indicated that studying the mechanisms bywhich co-activators and co-repressors interface with gene regulators and the transcriptionmachinery has become essential to understanding transcriptional regulation in eukaryotes.There are two categorizations of the regulation of gene expression in eucaryon. Onecategory is transient or reversible regulation which represents the response of procaryoticcell to environmental change. The other category is developmental or irreversible regulationwhich determines the growth, differentiation and development of eukaryotic cell. In theregulation of gene expression, transcription initiation is the most important control point,promoter is the DNA domain of transcription factor binding site and specific transcriptioninitiation (core promoter). Recent studies highlight the importance of core promoter, a betterunderstanding of promoter function sequence motif will contribute to the research on themechanisms of regulation of gene expression. The C中国煤 化iated betweenapproximately -35 and +35 relative to the transcriptiTYHCNMHG:.ne. When thefirst protein-coding genes were isolated, virtually every gene, regardless of its expression7pattern, contained an A/T-rich sequence 25- -30 base pairs (bp) upstream of the transcriptionstart site. This sequence, with the consensus TATAAA, was called the TATA box!26). Inmammals, core promoter structure appears to be evenmore diverse. Core promoter diver-sity is an important contributor to combinatorial regulation. Precise calculations have beendifficult because transcription start sites have been determined accurately for only a smallfraction of genes. TATA boxes are paired with Inr elements in a smaller percentage ofmammalian promoters, DPE elements exist in mammalian promoters, but have been difficultto identify, and many promoters, including a number of promoters within CpG islands, appearto lack all three of these core elementsl27. A TATA box and an Inr element was sufficient forstrong, accurately initiated transcription stimulated by transcription factor Sp1.Although all the core promoters have not been found identified sequence motif, manysequence motif have been confirmed, among them are TATA box, GC box, CAAT box,typical promoter consists of TATA box, upstream CCAAT box and /or GC box[28. For thefirst time in this study, promoter region of uPA gene in the testiculus of rat has been clonedand analyzed, which indicated that this fragment include eucaryon regulating region oftranscription, TATA box, very typical GC box , AP1, SP1 binding domain. It suggested thatthe fragment is the promoter region of the uPA gene.The clone and sequence analysis of uPA gene in genital system provided some experi-mental evidences for further study of interference with uPA gene regulation, which is veryimportant in several aspects. A fusion of spermatogenic theoretical gene and uPA genepromoter will make the theoretical gene highly express in specific tissue in order to treatazoospermatism, bringing hope to those masculine sterility; through regulation of uPA geneexpression in genital system, we will be able to improve the seminal viscidity, aprorsad loco-motory capacity and chemotaxy, induce capacitation and acrosomal reaction, increase rateof fertilization, thus make impregnation possible. The expression of the uPA gene can beinbibited at transcriptional level by suppression on the transcription of uPA gene promoter.Furthermore, enzymatic activity of genital system can also be inhibited so that spermaticejection, locomotion, capacitation, chemotaxis, acrosomal reaction, ferrtilization will beinterfered. Through the intervention of male procreation at different levels, the anticonceptiveobjective is achievable.To sum up, the clone and sequence analysis of uPA gene promoter in genital systemcombined with the gene therapy are expected to open new avenues for development of newmale contraceptives as well as provided reliable theorv for further exnlnration on interruptionof expression of uPA gene by siRNA techonolgy in中国煤化工nction changesof generative cell after blockage of the uPA gene.TYHCNMHGReferences1. Levin EG, Loskutoff DJ. Cultured bovine endothelial cells produce both urokinase and tissue-type plasmino-gen activators. J Cell Biol ,1982, 94(3):631-6.2. Clowes AW, Clowes MM, Au YPT, et al. Smooth muscle cells express urokinase during mitogenesis andtissue-type plasminogen activator during migration in injured rat carotid artery. Circ Res, 1990, 67(1):61-7.Kristensen P, Eriksen J, Dano K. Localization of urokinase-typc plasminogen activator messenger RNA inthe normal mouse by in situ hybridization. J Histochem Cytochem, 1991, 39(3):341-9.4. Penttila TL, Kaipia A, Toppari J, et al. Localization of urokinase- andtissue-type plasminogen activatormRNAs in rat testes. Mol Cell Endocrinol,1994, 105(1 ):55-64.5. Andreasen PA, Egelund R, Petersen HH. Theplasminogen activation system in tumor growth, invasion, andmetastasis. Cell Mol Life Sci, 2000, 57(1):25-40.Li H, Soria C, Griscelli F, et al. Amino-terminal fragment of urokinase inhibits tumor cell invasion in viro andin vivo: respective contribution of the urokinase plasminogen activator receptor-dependentor-independentpathway. Hum Gene Ther, 2005,16(10):1 157-67.Mengele K, Harbeck N, Reuning U, el al. Tumor-associated prognostic factors of the plasminogen activatorfamily: determination and clinical value of u-PA, t-PA, PAI-1, and PAI-2. Hamostaseologie, 2005, 25(3):301-0.8. Iwamoto J, Mizokami Y, Takahashi K, et al. Expressions of urokinase-type plasminogen activator, itsreceptor and plasminogen activator inhibitor-1 in gastric cancer cells and effects of Helicobacter pylori. ScandJ Gastroenterol, 2005, 40(7):783-93.9. Allen BJ, Tian Z, Rizvi SMA, et al. Preclinicalstudies of targeted a therapy for breast cancer using 213bilabelled plasminogen activator inhibitor type 2. Br J Cancer, 2003, 88(6):944-50.10. Taran LD. Plasminogen activators and thrombolytic therapy. Biomed Khim, 2005, 51(3):248-62.11. Lijnen HR. Plasmin and matrix metalloproteinases in vascular remodeling. Thromb Haemost, 2001, 86(1): .324-33.12. Li Y, Rizvi SMA, Ranson M, et al.213Bi-PAI2 conjugate selectively induces apoptosis in PC3 metastaticprostate cancer cell line and shows anti cancer activity in a xenograft animal model. Br J Cancer, 2002, 86(7):.1 197-203.13. Maier U, Kirchheimer JC, Hienert G, et al. Fibrinolytic parametes in spermatozoas and seminal plasma.」Urol, 1991, 146(3):906-8.14. Smokovitis A , Kokolis N, Alexopoulos C, et al. Plasminogen activator activity, plasminogen activatorinhibition and plasmin inhibition in spermatozoa and seminal plasma of man and various animal species-effect of plasmin on sperm motility. Fibrinolysis, 1987, 1:253. .15. Liu YX, Hu ZY, Feng Q, et al. In situ hybridization and immunofluorescent localization of tPA. uPA, PAI-Iand PAI-2 in human and rhesus monkey placentae. Dev Reprod Biol, 2000, 9(1):1-9.16. Huang XB, Xiong CL, Xia WJ, et al. Comparative studies on the urokinase activator in human seminal plasmaand on spermatoza between infertile patients w ith asthenospermia and healthy fertile men. J Reprod Med,1996, 4(5):207-10.17. Xiong CL, Shen JY, Zhou JL, et al. Effect of urokinase on sperm viability and sperm motility of infertile menwith asthenospermia. J Reprod Med,1995, 4(3):164-6.18. Ying J, Yao DH. Clinical study of highly viscous semen tr中国煤化工Nan Ke Xue (inChinese), 2002, 16(2):105-7.[HCNMH G19. Zheng P, Zou RJ, Liu YX. Source of plasminogen activator In rmnesus monkey semen ana its possible role insperm capacitation. Acta Physiol Sin, 2001, 53(1):45-50.20. Zheng P, Zou RJ, Liu YX. Possible involvement of plasminogen activator in the acquirement of spermprogressive motility and the regulation of PA and PA]-I mRNA expressions in epididymis, prostate andsemina!l vesical in rhesus monkey. Zoological Research, 2002, 23(1):19-24.21. Ding XF, Xiong CL. Effccts of urokinase type plasminogen activa tor on chemotactic responses of spermatozonin viro. National J Androl, 2005, 11(6):409-18.22. Xiong CL, Zhao TH, Weng N. et al. Comparative study on level of urokinase tye plasminogen activator inmedium containing fertilized oocytes and unfertilized oocytes. Reprod Contracep (in Chinese),1998, 18(6):342-5.23. Marchand S, Hajdari P, Hackman P, et al. Touch-down method for high-performance sequencing of poly-merase chain reaction products. Anal Biochem, 2003, 315():270-2.24. Kim SK, Lee SB, Kang TI, et al. Detection of gene mutations related with drug resistance in Mycobacteriumleprae from leprosy patients using Touch-Down (TD) PCR. FEMS Immunol Med Microbiol, 2003, 36(1-2):27-32.25. Lemon B, Tjian R. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev,2000, 14(20): 2551-69.26. Pugh BF Control of gene expression through regulation of the TATA-binding protein. Gene, 2000, 255(1):1-14.27. Smale ST. Core promoters: active contributors to combina-torial gene expression. Genes Dev, 2001, 15(19):2503-8.28. Romier C, Cochiarella F, Mantovani R, et al. The NFYB/NF_YC structure gives insight into DNA bindingand transcription regulation by CCAAT factor NF-Y. J Biol Chem, 2003, 278(2):1 336-45.(Received on July 25, 2006)中国煤化工MYHCNMHG10